Course Solutions Uncategorized (Solved) : Write Sequence Complementary Strand Spaces Provided Label 5 3 Ends Complementary Strand 5 Q32431386 . . . .

(Solved) : Write Sequence Complementary Strand Spaces Provided Label 5 3 Ends Complementary Strand 5 Q32431386 . . . .

 

A.) Write out the sequence of the complementary strand in thespaces provided and label the 5′ and 3′ ends of this complementarystrand: 5′ Promoter GATGGCTACCGAGCTACAGGACTGAG 3′ B.) If the DNAsequence that you wrote out in A) is the transcription templatestrand, write out, in the 5′ to 3′ orientation, the RNA transcriptthat would be produced by RNA polymerase. c) Using the genetic codetable provided, write the amino acid sequence of peptide that wouldbe produced by RNA transcript in B), starting from the likelyinitiation codon.

Expert Answer


An answer will be send to you shortly. . . . .

Leave a Reply

Your email address will not be published. Required fields are marked *

Related Post