(Solved) : Assume Text File Named Texttxt Contains Like Nzfnbk010000551 Halorientalis Regularis Strai Q35571166 . . . .

Assume that I have a text file named “text.txt” which hascontains like this:

>NZ_FNBK01000055.1 Halorientalis regularis strain IBRC-M10760, whole genome shotgun sequence
CCCTCCTCCAGGGCGGCCATGCCCCAGCCGTCGATCTCGTGGCCGTCGTCTCCGGTGACGACCTCGCGCAGCGTGGCGAC
GGCGTCCTCGATCCGGTCGCGGCTCTCTGCACCCGACCGGCCGAACGGATAGGTGGTCACACTGCCGACCGCGTGCTGAT
CCAGCGCTTCCTCAGCGCGCTCGACGTCGGTCGGTTCGTCGGGTTCGAAGCCGCGGAGGCCCCAGTCGTCGGGCATGTTG
>NZ_FNBK01000053.1 Halorientalis regularis strain IBRC-M 10760,whole genome shotgun sequence
GCGGTGCGGTTCGGGAAGCCTCGCCGTCGTCGGGCTACGCCCGACTGCTTGAGGGAGCTTCGCTCCCTCTCCGTTCACGG
CGAGGAGGAGGTCACGCCGTCACCAAGCGCGGCCGCCGGGAAATCGAGGCCCGGCGCGAGTGGGAACAGCAATACTTCGA
CTGGTAGGCACCCGCCCAGCCAGCCGCACCCTGGCCGCGATCCGACCGCTGTCGTGGAAACAGGCGTCCACACGCGACGA

So, how can I read the data from the above file that:

1. Extract the genome name from a line in the file that beginswith a greater than

sign; everything following the greater-than sign (and excludingthe newline at the

end of the line) is the name, so for the line

>NZ_FOJA01000002.1 Halobacterium jilantaiense strain CGMCC1.5337, whole genome shotgun sequence

the name would be

NZ_FOJA01000001.1 Halobacterium jilantaiense strain CGMCC1.5337, whole genome shotgun sequence

2. Extract the sequence of DNA bases